View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0754_low_33 (Length: 309)

Name: NF0754_low_33
Description: NF0754
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0754_low_33
NF0754_low_33
[»] chr6 (1 HSPs)
chr6 (88-153)||(31936033-31936106)


Alignment Details
Target: chr6 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 88 - 153
Target Start/End: Complemental strand, 31936106 - 31936033
Alignment:
88 ataaatccattttgttatgacatggtcaaaactatgtc--------agagttgttgactatgttaagaacggtt 153  Q
    ||||||||||||||||||||||||||||||||||||||        ||||||||||||||||||||||||||||    
31936106 ataaatccattttgttatgacatggtcaaaactatgtcagagactcagagttgttgactatgttaagaacggtt 31936033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2745 times since January 2019
Visitors: 4801