View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0754_low_36 (Length: 282)

Name: NF0754_low_36
Description: NF0754
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0754_low_36
NF0754_low_36
[»] chr4 (1 HSPs)
chr4 (47-233)||(55738491-55738677)
[»] chr2 (1 HSPs)
chr2 (108-197)||(9379646-9379735)


Alignment Details
Target: chr4 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 47 - 233
Target Start/End: Original strand, 55738491 - 55738677
Alignment:
47 acatcaaagtatccaaagcattaattaaagcagtattgtaaaatgcagttgctgatcatattatggatgacaagaaggatcacagatgacattcccggat 146  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55738491 acatcaaagtatccaaagcattaattaaagcagtattgtaaaatgcagttgctgatcatattatggatgacaagaaggatcacagatgacattcccggat 55738590  T
147 ggggaacttttttccatggccttgttggtggtggaagtgtcagtgtaagtactacatgtatctctcttttgtcttcagattgaagtc 233  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55738591 ggggaacttttttccatggccttgttggtgatggaagtgtcagtgtaagtactacatgtatctctcttttgtcttcagattgaagtc 55738677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 108 - 197
Target Start/End: Original strand, 9379646 - 9379735
Alignment:
108 tatggatgacaagaaggatcacagatgacattcccggatggggaacttttttccatggccttgttggtggtggaagtgtcagtgtaagta 197  Q
    |||||||||||||||| ||  |||||||| | || |||||||||  ||| ||||||||||||||||||| ||||||  ||||||||||||    
9379646 tatggatgacaagaagaatatcagatgacttacctggatggggagttttgttccatggccttgttggtgatggaagcatcagtgtaagta 9379735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 4085 times since January 2019
Visitors: 4827