View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0754_low_36 (Length: 282)
Name: NF0754_low_36
Description: NF0754
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0754_low_36 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 47 - 233
Target Start/End: Original strand, 55738491 - 55738677
Alignment:
| Q |
47 |
acatcaaagtatccaaagcattaattaaagcagtattgtaaaatgcagttgctgatcatattatggatgacaagaaggatcacagatgacattcccggat |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55738491 |
acatcaaagtatccaaagcattaattaaagcagtattgtaaaatgcagttgctgatcatattatggatgacaagaaggatcacagatgacattcccggat |
55738590 |
T |
 |
| Q |
147 |
ggggaacttttttccatggccttgttggtggtggaagtgtcagtgtaagtactacatgtatctctcttttgtcttcagattgaagtc |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55738591 |
ggggaacttttttccatggccttgttggtgatggaagtgtcagtgtaagtactacatgtatctctcttttgtcttcagattgaagtc |
55738677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 108 - 197
Target Start/End: Original strand, 9379646 - 9379735
Alignment:
| Q |
108 |
tatggatgacaagaaggatcacagatgacattcccggatggggaacttttttccatggccttgttggtggtggaagtgtcagtgtaagta |
197 |
Q |
| |
|
|||||||||||||||| || |||||||| | || ||||||||| ||| ||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
9379646 |
tatggatgacaagaagaatatcagatgacttacctggatggggagttttgttccatggccttgttggtgatggaagcatcagtgtaagta |
9379735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University