View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0754_low_41 (Length: 272)
Name: NF0754_low_41
Description: NF0754
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0754_low_41 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 30 - 227
Target Start/End: Complemental strand, 526117 - 525920
Alignment:
Q |
30 |
agcagagagacgttgcgattggaacatatatgtaagtgggtcatgtagtataagaaactaaaaaacaagtgggtgggggtgtgggaagggaattatggaa |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
526117 |
agcagagagacgttgcgattggaacatatatgtaagtgggtcatgtagtataagaaactaaaaaacaagtgggtgggggtgtgggaagggaattatggaa |
526018 |
T |
 |
Q |
130 |
ctgctatggtttaagaggttgtcctaaaagagaatgaaaaaacacatgcaaaatgagtttgaatatgatagaagattattacttaggagatggtgatg |
227 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||| ||||||| |||||||| |
|
|
T |
526017 |
ctgctatggtttaagaggttgtcctaaaagagaatgaaaaaacacatgaaaaatgagtttgaatatgatataagattattagttaggaggtggtgatg |
525920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University