View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0754_low_42 (Length: 264)
Name: NF0754_low_42
Description: NF0754
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0754_low_42 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 82; Significance: 8e-39; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 63 - 152
Target Start/End: Original strand, 43953470 - 43953559
Alignment:
| Q |
63 |
tagctgttgcaaaactctctatctccaacaatcaatggcgacgatttcgttggcaaacggtttaaaaactcttttcagtgttttgggaac |
152 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43953470 |
tagctattgcaaaactctctatctccaacaatcaatggcgacgatttcattggcaaacggtttaaaaactcttttcagtgttttgggaac |
43953559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 150 - 235
Target Start/End: Complemental strand, 46630917 - 46630832
Alignment:
| Q |
150 |
aacaggagtagttggattttctggtccatttgaaaaattctggtttgtgttacatttttccttctctttttctttgtccttcttcc |
235 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46630917 |
aacaggagtagttggattttctgttccatttgaaaaattctggtttgtgttacatttttccttctctttttctttgtccttcttcc |
46630832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University