View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0754_low_43 (Length: 260)
Name: NF0754_low_43
Description: NF0754
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0754_low_43 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 39 - 260
Target Start/End: Original strand, 55451608 - 55451829
Alignment:
| Q |
39 |
agtatagatagtttcacaaccgcgtgtacattcagatttgatttgatggcaagatcatcttcaaaatctatctatatacgtcatttctatcactgatttt |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55451608 |
agtatagatagtttcacaaccgcgtgtacattcagatttgatttgatggcaagatcatcttcaaaatctatctatatacgtcatttctatcactgatttt |
55451707 |
T |
 |
| Q |
139 |
aatgatgttattgctatatttttccttttgatcatatcaaaacactcttgttgttatcagtatgaatgaaccataacagtaagtaacaaaatatatcaaa |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55451708 |
aatgatgttattgctatatttttccttttgatcatatcaaaacactcttgttgttatcagtatgaatgaaccataacagtaagtaacaaaatatatcaaa |
55451807 |
T |
 |
| Q |
239 |
atgatgaaaaatatcaataaca |
260 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
55451808 |
atgatgaaaaatatcaataaca |
55451829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University