View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0754_low_44 (Length: 259)
Name: NF0754_low_44
Description: NF0754
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0754_low_44 |
 |  |
|
[»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 30 - 259
Target Start/End: Complemental strand, 40174934 - 40174705
Alignment:
Q |
30 |
gctgcaatggctggtcctggaattggacgtgctgctggtagaggtattcctccggcgccggttattcaagctcagcctggtcttgctggtcctgttcgtg |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40174934 |
gctgcaatggctggtcctggaattggacgtgctgctggtagaggtattcctccggcgccggttattcaagctcagcctggtcttgctggtcctgttcgtg |
40174835 |
T |
 |
Q |
130 |
gtgttggtggacctgctcctggtatgatgcagccgcagatctcgcggccacctgtttcgtatcctggtggtccgcctgttatgcgtccgcctggtcaaat |
229 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
40174834 |
gtgttggtggacctgctcctggtatgatgcagccgcagatctcgcggccgcctgtttcgtatcctggtggtccgcctgttatgcgtccacctggtcaaat |
40174735 |
T |
 |
Q |
230 |
gccgtatcctggacatcctggacaaggtcc |
259 |
Q |
|
|
|||||||||||||||||||||||||||||| |
|
|
T |
40174734 |
gccgtatcctggacatcctggacaaggtcc |
40174705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 139; Significance: 8e-73; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 30 - 238
Target Start/End: Original strand, 34400686 - 34400900
Alignment:
Q |
30 |
gctgcaatggctggtcctggaattggacgtgctgctggtagaggtattcctcc---ggcgccggttattcaagctcagcctggtcttgctggtcctgttc |
126 |
Q |
|
|
|||||||||||||||||||||||||| ||||||||||| |||||||||||||| |||| | ||||||||||||||||||||||||||||||||||||| |
|
|
T |
34400686 |
gctgcaatggctggtcctggaattggtcgtgctgctggaagaggtattcctcctccggcgacagttattcaagctcagcctggtcttgctggtcctgttc |
34400785 |
T |
 |
Q |
127 |
gtggtgttggtggacctgctcctggtatgatgcagccgcagatctcgcggccacctgtttcgtatcctggtggtccgcctgttatgcgt---ccgcctgg |
223 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| |||||||| || || ||||||||||| ||||||||||| ||||||||| |||||||| |
|
|
T |
34400786 |
gtggtgttggtggacctgctcctggtatgatgcagccgcaaatctcgcgtcctccggtttcgtatcccggtggtccgccggttatgcgtccaccgcctgg |
34400885 |
T |
 |
Q |
224 |
tcaaatgccgtatcc |
238 |
Q |
|
|
||| ||||| ||||| |
|
|
T |
34400886 |
tcagatgccatatcc |
34400900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3767 times since January 2019
Visitors: 4821