View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0754_low_46 (Length: 258)
Name: NF0754_low_46
Description: NF0754
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0754_low_46 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 47 - 239
Target Start/End: Original strand, 34046624 - 34046816
Alignment:
Q |
47 |
gttgaggcaagataaaataaactaattatcaatttagagttgaatcttagacccgccaaaatatttataccattgaattgaatctttccaatcattttaa |
146 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34046624 |
gttgaggcaagataaaataaactaattatcaatttagagttgaatcttagacccgccaaaatatttataccattgaattgaatctttccaatcattttaa |
34046723 |
T |
 |
Q |
147 |
cccttggctaatttgatatattgaagcattataatcaaatgtcacacttttaagggcaccttttagttggtagcttaattgtcttcattctct |
239 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34046724 |
cccttggctaatttgatatattgaagcattataatcaaatgtcacacttttaagggcaccttttagttggtagcttaattgtcttcattctct |
34046816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4369 times since January 2019
Visitors: 4835