View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0754_low_53 (Length: 239)
Name: NF0754_low_53
Description: NF0754
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0754_low_53 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 157
Target Start/End: Complemental strand, 2452066 - 2451910
Alignment:
| Q |
1 |
aaaaaccaatgtgaggaaggaaatacatttggagaaggaagacataaacaagaaacatgatggtgcagtggtagatggagaattgcactagtggatggtt |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2452066 |
aaaaaccaatgtgaggaaggaaacacatttggagaaggaagacataaacaagaaacatgatggtgcagtggtagatggagaattgcactagtggatggtt |
2451967 |
T |
 |
| Q |
101 |
tatttggtttgtaaagctttatctttatgcaaaagatttgtattttgtgatgatgtc |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
2451966 |
tatttggtttgtaaagctttatctttatgcaaacgatttgtattttgtaatgatgtc |
2451910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University