View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0754_low_58 (Length: 213)

Name: NF0754_low_58
Description: NF0754
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0754_low_58
NF0754_low_58
[»] chr2 (2 HSPs)
chr2 (1-87)||(5823628-5823714)
chr2 (16-87)||(5766235-5766306)


Alignment Details
Target: chr2 (Bit Score: 79; Significance: 4e-37; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 1 - 87
Target Start/End: Complemental strand, 5823714 - 5823628
Alignment:
1 actgctatggtgtcggcatttctaatagttgttaaacggtgtgcaacaactacggtagtcctttgtgtcataactttttcctatgct 87  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
5823714 actgctatggtgtcagcatttctaatagttgttaaacggtgtgcaacaactacggtagtcctttgtgtcataactttttccaatgct 5823628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 16 - 87
Target Start/End: Complemental strand, 5766306 - 5766235
Alignment:
16 gcatttctaatagttgttaaacggtgtgcaacaactacggtagtcctttgtgtcataactttttcctatgct 87  Q
    |||||||| |||||||||||||| |||||||||||||||||||| ||||||||||||||||||||| |||||    
5766306 gcatttcttatagttgttaaacgatgtgcaacaactacggtagttctttgtgtcataactttttccaatgct 5766235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University