View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0755_high_47 (Length: 270)
Name: NF0755_high_47
Description: NF0755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0755_high_47 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 10 - 249
Target Start/End: Original strand, 47793744 - 47793983
Alignment:
| Q |
10 |
gcacagaggaaaaaggaggttattattagaggagtcctttctgttactgtgatatcagccgaagacttgcctgccgtggatttcatggggaaatctgatc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47793744 |
gcacagaggaaaaaggaggttattattagaggagtcctttctgttactgtgatatcagccgaagacttgcctgccgtggatttcatggggaaatctgatc |
47793843 |
T |
|
| Q |
110 |
cttttgttgttcttacattgaagaaagcagaaacaaagaacaaaaccagggtaagattttgatggaccaagaaccccatatagcattgactttataacct |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47793844 |
cttttgttgttcttacattgaagaaagcagaaacaaagaacaaaaccagggtaagattttgatggaccaagaaccccatatagcattgactttataacct |
47793943 |
T |
|
| Q |
210 |
ttttgaattagagatcagcttacaactgttactgatgatg |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47793944 |
ttttgaattagagatcagcttacaactgttactgatgatg |
47793983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5834 times since January 2019
Visitors: 4860