View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0755_high_59 (Length: 251)
Name: NF0755_high_59
Description: NF0755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0755_high_59 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 17 - 246
Target Start/End: Complemental strand, 42898203 - 42897974
Alignment:
Q |
17 |
tatcaaatactattgttggaatctgaattaagcgctcgtaccaaaattgctatgctccaaagaacatatctgtttttcacttaactggttagtaattctg |
116 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42898203 |
tatcaaatactattgttggaatctgaattaagcgctcgtaccaaaattgctatgctccaaagaacatatctgtttttcacttaactggttagtaattctg |
42898104 |
T |
 |
Q |
117 |
agttttacattctttgtatttaggtgttgaaatgggtagaatttgctgaaaccttgcttgtttctcttgacgaatgctttgagattctcaagagattaaa |
216 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
42898103 |
agttttacattctttgtatttaggtgttgaaatgggtagaatttgcagaaaccttgcctgtttctcttgacggatgctttgagattctcaagagattaaa |
42898004 |
T |
 |
Q |
217 |
cgatgaactatctggaaagtctctgctcct |
246 |
Q |
|
|
|||||||||||||||||||||| ||||||| |
|
|
T |
42898003 |
cgatgaactatctggaaagtctgtgctcct |
42897974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5489 times since January 2019
Visitors: 4854