View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0755_low_103 (Length: 282)
Name: NF0755_low_103
Description: NF0755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0755_low_103 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 107 - 258
Target Start/End: Complemental strand, 8931652 - 8931501
Alignment:
| Q |
107 |
ttttgtttctaatttgttgaattctgttgaaaatagtcatgatcatgatcataagggtttggattctacaaagtctacaccttttgatgttggtggtgct |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8931652 |
ttttgtttctaatttgttgaattctgttgaaaatagtcatgatcatgatgataacggtttggattctacaaagtctacaccttttgatgttggtggtgct |
8931553 |
T |
|
| Q |
207 |
gaaaatggtcatgatcatgatagtaagggtttgaattctgcatcttttgatg |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
8931552 |
gaaaatggtcatgatcatgatagtaagggtttgatttctgcatcttttgatg |
8931501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3697 times since January 2019
Visitors: 4818