View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0755_low_107 (Length: 278)
Name: NF0755_low_107
Description: NF0755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0755_low_107 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 23 - 257
Target Start/End: Original strand, 18632913 - 18633147
Alignment:
Q |
23 |
cacagagaccatacctgtttgtataaaaagcacatttatttgcaattttacactgatcttgctacacaaatcaaaccacattattgatacgcgtcaaaat |
122 |
Q |
|
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| |
|
|
T |
18632913 |
cacagagaccatacctatttgtataaaaagcacatttatttgcaattttacactgatcttgcaacacaaatcaaaccacattattgatacgcatcaaaat |
18633012 |
T |
 |
Q |
123 |
ataacctatgataatattatgcactaattagatcaaaatttacactagctttgcaacataaaccataccataatattatacctatgataatccaaatcat |
222 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
18633013 |
ataacctatgataatattatgcactaattagatcaaaatttacactaactttgcaacataaaccataccataatattatacctatgataatccaaatcat |
18633112 |
T |
 |
Q |
223 |
gcaatatatctgaaacaaaacatttagtgatgatg |
257 |
Q |
|
|
||||||||||||||||||||||||||||| ||||| |
|
|
T |
18633113 |
gcaatatatctgaaacaaaacatttagtggtgatg |
18633147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 176 - 251
Target Start/End: Original strand, 28975430 - 28975505
Alignment:
Q |
176 |
caacataaaccataccataatattatacctatgataatccaaatcatgcaatatatctgaaacaaaacatttagtg |
251 |
Q |
|
|
||||| ||| || ||||||||||||||| |||||||||||||||| ||||| |||| |||||||| |||||||| |
|
|
T |
28975430 |
caacacaaatcaaaccataatattatacatatgataatccaaatcgtgcaaaatattcaaaacaaaatatttagtg |
28975505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 116 - 232
Target Start/End: Complemental strand, 33270570 - 33270454
Alignment:
Q |
116 |
tcaaaatataacctatgataatattatgcactaattagatcaaaatttacactagctttgcaacataaaccataccataa-tattatacctatgataatc |
214 |
Q |
|
|
|||||| |||| |||||||||||| | || |||||| ||||||||||||| | ||||||||| ||| || ||||||| ||| |||| |||||||||| |
|
|
T |
33270570 |
tcaaaacataaggtatgataatatttt-cattaattaaatcaaaatttacattgattttgcaacacaaatcaaaccataaatatcatacatatgataatc |
33270472 |
T |
 |
Q |
215 |
caaatcatgcaatatatc |
232 |
Q |
|
|
|||||| ||||| ||||| |
|
|
T |
33270471 |
caaatcttgcaaaatatc |
33270454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5646 times since January 2019
Visitors: 4858