View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0755_low_118 (Length: 270)

Name: NF0755_low_118
Description: NF0755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0755_low_118
NF0755_low_118
[»] chr3 (4 HSPs)
chr3 (27-145)||(7413384-7413502)
chr3 (28-213)||(7413194-7413379)
chr3 (28-92)||(30495670-30495734)
chr3 (28-89)||(30447007-30447068)


Alignment Details
Target: chr3 (Bit Score: 119; Significance: 7e-61; HSPs: 4)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 27 - 145
Target Start/End: Complemental strand, 7413502 - 7413384
Alignment:
27 tgatatgaaacaaaagttggaatgggagattaggcaactaaaaggattactaactgcgttgaataacacaaagggacaacaaagagttagaagatgatga 126  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7413502 tgatatgaaacaaaagttggaatgggagattaggcaactaaaaggattactaactgcgttgaataacacaaagggacaacaaagagttagaagatgatga 7413403  T
127 tgttttggataaaataaat 145  Q
    |||||||||||||||||||    
7413402 tgttttggataaaataaat 7413384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 28 - 213
Target Start/End: Original strand, 7413194 - 7413379
Alignment:
28 gatatgaaacaaaagttggaatgggagattaggcaactaaaaggattactaactgcgttgaataacacaaagggacaacaaagagttagaagatgatgat 127  Q
    ||||||||||||||||| ||||| | |||| ||||||||||||||| ||||||||||||||||||||| ||||||||| ||||| ||||||||||||||     
7413194 gatatgaaacaaaagtttgaatgagtgattgggcaactaaaaggatcactaactgcgttgaataacac-aagggacaagaaagatttagaagatgatgaa 7413292  T
128 g-ttttggataaaataaattaattgcagatggaattgaaggaaaagcaagagttccttcaagcctgcgaagagttgaaccaaatgat 213  Q
    | ||||||||||||||||||  ||||||||||||||||| |||||| ||||||| |||||||||||||| |   |||||||||||||    
7413293 gtttttggataaaataaattctttgcagatggaattgaaagaaaaggaagagttacttcaagcctgcgagggcctgaaccaaatgat 7413379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 28 - 92
Target Start/End: Original strand, 30495670 - 30495734
Alignment:
28 gatatgaaacaaaagttggaatgggagattaggcaactaaaaggattactaactgcgttgaataa 92  Q
    |||||||||||||||||||||||||||||| ||||||||||||||| ||||| || |||||||||    
30495670 gatatgaaacaaaagttggaatgggagattgggcaactaaaaggatcactaattgtgttgaataa 30495734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 28 - 89
Target Start/End: Original strand, 30447007 - 30447068
Alignment:
28 gatatgaaacaaaagttggaatgggagattaggcaactaaaaggattactaactgcgttgaa 89  Q
    ||||||||||||||| |||||  |||||||  |||||||||||||| ||||| || ||||||    
30447007 gatatgaaacaaaagctggaactggagattcagcaactaaaaggatcactaagtgtgttgaa 30447068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 5912 times since January 2019
Visitors: 4860