View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0755_low_151 (Length: 251)
Name: NF0755_low_151
Description: NF0755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0755_low_151 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 22 - 251
Target Start/End: Original strand, 39057219 - 39057448
Alignment:
| Q |
22 |
catcatcttcaaaacaaaacaccacacacactccaacgttaatccatcaaaaacccatttcaatctttgtttcattcatccaaagttctcaactttttca |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
39057219 |
catcatcttcaaaacaaaacaccacacacactccaacgttaatccatcaaaaacccatttcaatctttgtttcattcatccaaagttctcgactttttca |
39057318 |
T |
 |
| Q |
122 |
caaaaacatcgtcagattctcttcaaccgatgcaaacaccgtttcagaattcattcatgtttgttttatgtaatcatcgtttccatgcttttctataatc |
221 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39057319 |
caaaaacatcatcagattctcttcaaccgatgcaaacactgtttcagaattcattcatgtttgttttatgtaatcatcgtttccatgcttttctataatc |
39057418 |
T |
 |
| Q |
222 |
cgatctgttacgatcgtaatgccactcatc |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
39057419 |
cgatctgttacgatcgtaatgccactcatc |
39057448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University