View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0755_low_152 (Length: 251)
Name: NF0755_low_152
Description: NF0755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0755_low_152 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 29 - 251
Target Start/End: Original strand, 13866100 - 13866322
Alignment:
| Q |
29 |
agttctagctaggaaaaatgagagatgaacatgattattatgaaattgatggtggaatttttagaagggaaatatatgaacggtttagttcttgatggtg |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13866100 |
agttctagctaggaaaaatgagagatgaacatgattattatgaaattgatggtggaatttttagaagggaaatatatgaacggtttagttcttgatggtg |
13866199 |
T |
|
| Q |
129 |
atgaaagcatgattaaaatatttgagggggtagggtatatgggaaattgtttaaatgttttatttttatatggaatgtgatttaattaagtgtggtttat |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
13866200 |
atgaaagcatgattaaaatatttgagggggtagggtatatgggaaattgtttaaatgttttatttttatatagaatgtgatttaattaagtgtggtttat |
13866299 |
T |
|
| Q |
229 |
ggaagacttagactttgtcattt |
251 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
13866300 |
ggaagacttagactttgtcattt |
13866322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4777 times since January 2019
Visitors: 4839