View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0755_low_184 (Length: 216)
Name: NF0755_low_184
Description: NF0755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0755_low_184 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 1 - 182
Target Start/End: Original strand, 7368146 - 7368327
Alignment:
| Q |
1 |
ttagttataggctgttcgttaagaataacaaaccaactaaactaacaattttaatgcgatccttccaagtttcaaacatattccttatcatataagttcg |
100 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
7368146 |
ttagttataggttgctcgttaagaataacaaaccaactaaactaacaattttaatgcgatccttccaagtttcaaacatattccttgtcatataagttcg |
7368245 |
T |
|
| Q |
101 |
atatctcattgatgatgcgtattttttaatagagaaagtgtaactcttactaagtaatgaagctaagtttcataccaaaatg |
182 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7368246 |
atatctcattgatgatgtgtattttttaatagagaaagtgtaactcttactaagtaatgaagctaagtttcataccaaaatg |
7368327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5573 times since January 2019
Visitors: 4857