View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0755_low_187 (Length: 202)
Name: NF0755_low_187
Description: NF0755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0755_low_187 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 152 - 193
Target Start/End: Original strand, 28447982 - 28448023
Alignment:
| Q |
152 |
tttgggctttggctggccttggcttcggtgttcctctctctg |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28447982 |
tttgggctttggctggccttggcttcggtgttcctctctctg |
28448023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 155 - 193
Target Start/End: Original strand, 18690607 - 18690645
Alignment:
| Q |
155 |
gggctttggctggccttggcttcggtgttcctctctctg |
193 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
18690607 |
gggctttggttggccttggcttcggtgttcctctctctg |
18690645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4987 times since January 2019
Visitors: 4844