View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0755_low_47 (Length: 366)
Name: NF0755_low_47
Description: NF0755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0755_low_47 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 89 - 356
Target Start/End: Complemental strand, 35302826 - 35302559
Alignment:
| Q |
89 |
acatcatcaacttcctcaaacaacaacctgcgaaaccatattccaccnnnnnnntctggtttcaaactctatgaaagaagaaactctttgaaaaatcttc |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35302826 |
acatcatcaacttcctcaaacaacaacctgcgaaaccatattccaccaaaaaaatctggtttcaaactctatgaaagaagaaactctttgaaaaatcttc |
35302727 |
T |
|
| Q |
189 |
acctaaacccattacttcctgttttctcttcaaattcaaacaacccttcaagcttttcacctagaaaacctgaaattttgtctcctagtatcctagattt |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35302726 |
acctaaacccattacttcctgttttctcttcaaattcaaacaacccttcaagcttttcacctagaaaacctgaaattctgtctcctagtatcctagattt |
35302627 |
T |
|
| Q |
289 |
tcctgcgcttgttcttagccctgttacacctcttataccggacccttttaacagaaccgccgtctctg |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
35302626 |
tcctgcgcttgttcttagccctgttacacctcttataccggacccttttaacagaaccaccgtctctg |
35302559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 47; Significance: 9e-18; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 266 - 340
Target Start/End: Original strand, 3840353 - 3840427
Alignment:
| Q |
266 |
ttgtctcctagtatcctagattttcctgcgcttgttcttagccctgttacacctcttataccggacccttttaac |
340 |
Q |
| |
|
||||| ||||||||||||||||||||| | |||||||||||||| |||||||| |||||||| ||||| |||||| |
|
|
| T |
3840353 |
ttgtcacctagtatcctagattttccttctcttgttcttagcccggttacaccacttatacccgacccatttaac |
3840427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 146 - 174
Target Start/End: Original strand, 3840239 - 3840267
Alignment:
| Q |
146 |
ggtttcaaactctatgaaagaagaaactc |
174 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
3840239 |
ggtttcaaactctatgaaagaagaaactc |
3840267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5896 times since January 2019
Visitors: 4860