View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0755_low_58 (Length: 350)
Name: NF0755_low_58
Description: NF0755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0755_low_58 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 133 - 350
Target Start/End: Complemental strand, 30731536 - 30731330
Alignment:
| Q |
133 |
ttatataaagtaaacacatcacgtgactaccacagtttgatatcaaaagcttaccacttatattctcccatcatattatccttcatcaatttcctattaa |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
30731536 |
ttatataaagtaaacacatcacgtgactaccacagtttgatagcaaaagcttaccacttatattctcccatcacattatccttcatcaa----------- |
30731448 |
T |
|
| Q |
233 |
aatttcttaccattacattacaactttttgtcttttctttttctacttaattattcttccttccaaattttagtagtaagaaatagggatattccaacaa |
332 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30731447 |
aatttcttaccattacattacaactttttgtcttttctttttctacttaattattcttccttccaaattttagtagtaagaaatagggatattccaacaa |
30731348 |
T |
|
| Q |
333 |
aaataaaaatatccacct |
350 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
30731347 |
aaataaaaatatccacct |
30731330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5421 times since January 2019
Visitors: 4850