View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0755_low_84 (Length: 320)
Name: NF0755_low_84
Description: NF0755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0755_low_84 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 158; Significance: 5e-84; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 158; E-Value: 5e-84
Query Start/End: Original strand, 73 - 238
Target Start/End: Complemental strand, 2452075 - 2451910
Alignment:
Q |
73 |
agtgagatgaaaaaccaatgtgaggaaggaaacacatttggagaaggaagacataaacaagaaacatgatggtgcagtggtagatggagaattgcactag |
172 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2452075 |
agtgagatgaaaaaccaatgtgaggaaggaaacacatttggagaaggaagacataaacaagaaacatgatggtgcagtggtagatggagaattgcactag |
2451976 |
T |
 |
Q |
173 |
tggatggtttatttggtttgtaaagctttatctttatgcaaaagatttgtattttgtgatgatgtc |
238 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
T |
2451975 |
tggatggtttatttggtttgtaaagctttatctttatgcaaacgatttgtattttgtaatgatgtc |
2451910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University