View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0756_high_4 (Length: 254)
Name: NF0756_high_4
Description: NF0756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0756_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 9 - 234
Target Start/End: Complemental strand, 54724608 - 54724383
Alignment:
| Q |
9 |
tcaatttactcttagctcctccataagtcatagtgagctgacaaaccacatgagctaagcattgtattcagaatcagagataaataacaattgtggctgt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
54724608 |
tcaatttactcttagctcctccataagtcatagtgagctgacaaaccacatgagctaagcattgtattcagaatcagagataaataacaattgtggctat |
54724509 |
T |
 |
| Q |
109 |
gtgatagatagttctgtcacatagctacttcatgtgtctactttatttattttactattgtttagcatgatatgatgaatctaaaatgtcttgtacgttg |
208 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54724508 |
gtggtagatagttctgtcacatagctacttcatgtgtctattttatttattttactaatgtttagcatgatatgatgaatctaaaatgtcttgtacgttg |
54724409 |
T |
 |
| Q |
209 |
tcaaaaggttaggaatatgatgatgt |
234 |
Q |
| |
|
|||||| ||||||||||||||||||| |
|
|
| T |
54724408 |
tcaaaaagttaggaatatgatgatgt |
54724383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University