View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0756_low_10 (Length: 361)
Name: NF0756_low_10
Description: NF0756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0756_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 82 - 333
Target Start/End: Original strand, 50654274 - 50654524
Alignment:
| Q |
82 |
gatggacatcatcacccttctaccccagtcnnnnnnngtataggatgagagaatggaataacataggttataaacttggtggcttctaaggtgagagagc |
181 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
50654274 |
gatgaacatcatcacccttctaccccagtcaaaaaaagtataggatgagagaatggaataacataggttataaacttggtggcaga-aaggtgagagagc |
50654372 |
T |
 |
| Q |
182 |
catcaagttcctcaccagtgtactattggatctattaaaataattaaagggttcagatatattaaaaaattaagagtagcacataagtcttccctcaccc |
281 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50654373 |
catcaagttcctcaccagtgtaccattggatctattaaaataattaaagggttcagatatattaaaaaattaagagtagcacataagtcttccctcaccc |
50654472 |
T |
 |
| Q |
282 |
aatccctccttgtttaactctttccctgctaaaccttccttgtgatgatgtc |
333 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
50654473 |
aatccctccttgtttaactctttccctgctaaaccttccttgttatgatgtc |
50654524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University