View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0756_low_12 (Length: 302)
Name: NF0756_low_12
Description: NF0756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0756_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 6e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 69 - 250
Target Start/End: Original strand, 2095941 - 2096127
Alignment:
| Q |
69 |
acatcatcaccaacatatttcagcttttttatataaaagcaagcaaaaataagtaaaaggccaaacaacataagaaaaccacataaatgt-----atatg |
163 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2095941 |
acatcataaccaacatatttcagcttttttatataaaagcaagcaaaaataagtaaaaggccaaacaacataagaaaaccacataaatgtagtcaatatg |
2096040 |
T |
 |
| Q |
164 |
tccacaaataatcactttgtcgtaaacaaatacttcaatgccatgttgcatacttttcaaataatttgtcccaacatctgtgctcct |
250 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2096041 |
tccacaaataatcacttagtcgtaaacaaatactttaatgccatgttgcatacttttcaaataatttgtcccaacatctgtgatcct |
2096127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University