View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0756_low_19 (Length: 254)
Name: NF0756_low_19
Description: NF0756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0756_low_19 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 22 - 247
Target Start/End: Original strand, 30177465 - 30177690
Alignment:
| Q |
22 |
ctgtgacaacggtctgaggtacatgattaagataaatcttcaatcttcttctagcatcaccacaacactcgctcccaaagaatcaagaatgccaatttgg |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
30177465 |
ctgtgacaacggtctgaggtacatgattaagataaatcttcaatcttcttctagcatcaccacaacactcactcccaaagaatcaagaatgccaatttgg |
30177564 |
T |
|
| Q |
122 |
gaacaaacgaatgcacaaaaatttaaccatcaggtagaagcaactactcaaagcttaatcacttaacagaagcaaaggttctcaacaatgagaaaaacca |
221 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30177565 |
gaacaaacaaatgcacaaaaatttaaccatcaggtagaagcaactactcaaagcttaatcacttaacagaagcaaacgttctcaacaatgagaaaaacca |
30177664 |
T |
|
| Q |
222 |
aactgcaacgatattaggtctgtgct |
247 |
Q |
| |
|
|||||||| ||||||||||||||||| |
|
|
| T |
30177665 |
aactgcaatgatattaggtctgtgct |
30177690 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University