View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0756_low_3 (Length: 513)

Name: NF0756_low_3
Description: NF0756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0756_low_3
NF0756_low_3
[»] chr3 (1 HSPs)
chr3 (66-184)||(21657851-21657969)
[»] chr2 (2 HSPs)
chr2 (322-391)||(30365969-30366037)
chr2 (25-57)||(30366106-30366138)


Alignment Details
Target: chr3 (Bit Score: 87; Significance: 2e-41; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 66 - 184
Target Start/End: Complemental strand, 21657969 - 21657851
Alignment:
66 ttagcaattgatatgataatccatttggccttaacttgatcttcatctctagtttcattttcaccgacaaatggtttttgaaaatctatatactctttaa 165  Q
    |||| ||||||||||| |||||||||| |||| |||||||||||||||||||||||||||||| ||||| ||| ||||||||||||||||||||||||||    
21657969 ttagtaattgatatgagaatccatttgaccttgacttgatcttcatctctagtttcattttcatcgacatatgatttttgaaaatctatatactctttaa 21657870  T
166 ttagcttgcaccttttttc 184  Q
    |||||||||| ||||||||    
21657869 ttagcttgcatcttttttc 21657851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 54; Significance: 9e-22; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 322 - 391
Target Start/End: Complemental strand, 30366037 - 30365969
Alignment:
322 aagcagctaacagagccataaattgtgatttggttgagtgaaatcgaacagagcaacaacaacagtgaac 391  Q
    |||||||||||||||| | |||| ||||||||||||||||||||||||||||||||||||||||||||||    
30366037 aagcagctaacagagcaa-aaatcgtgatttggttgagtgaaatcgaacagagcaacaacaacagtgaac 30365969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 30366138 - 30366106
Alignment:
25 catcatacgagaccacaaaccacaaaattcctt 57  Q
    |||||||||||||||||||||||||||||||||    
30366138 catcatacgagaccacaaaccacaaaattcctt 30366106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University