View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0756_low_6 (Length: 422)

Name: NF0756_low_6
Description: NF0756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0756_low_6
NF0756_low_6
[»] chr6 (1 HSPs)
chr6 (359-404)||(7310463-7310508)
[»] chr2 (2 HSPs)
chr2 (337-412)||(11316257-11316331)
chr2 (344-394)||(32470300-32470350)
[»] chr8 (3 HSPs)
chr8 (54-107)||(22552201-22552254)
chr8 (357-394)||(32694264-32694301)
chr8 (357-394)||(32797491-32797528)
[»] chr5 (1 HSPs)
chr5 (357-394)||(30858248-30858285)
[»] chr3 (1 HSPs)
chr3 (359-404)||(38241246-38241291)
[»] scaffold0118 (1 HSPs)
scaffold0118 (357-394)||(42646-42683)
[»] chr4 (1 HSPs)
chr4 (228-256)||(33962309-33962337)


Alignment Details
Target: chr6 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 359 - 404
Target Start/End: Complemental strand, 7310508 - 7310463
Alignment:
Q  359 gatgatgttgctgttgaattgatgacgatgttgttgctgctattgt 404  Q
    ||||||||||||||||||||||||| | ||||||||||||||||||    
T  7310508 gatgatgttgctgttgaattgatgatgttgttgttgctgctattgt 7310463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 36; Significance: 0.00000000004; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 337 - 412
Target Start/End: Complemental strand, 11316331 - 11316257
Alignment:
Q  337 atggttcattttgataactagtgatgatgttgctgttgaattgatgacgatgttgttgctgctattgtataatctg 412  Q
    |||||| |||||||||  | |||||||||||| |||||||||||||| | |||||||| ||||||||| |||||||    
T  11316331 atggtttattttgatagatggtgatgatgttgttgttgaattgatgatgttgttgttg-tgctattgtttaatctg 11316257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 344 - 394
Target Start/End: Original strand, 32470300 - 32470350
Alignment:
Q  344 attttgataactagtgatgatgttgctgttgaattgatgacgatgttgttg 394  Q
    |||||||||  | |||||||||||| |||||||||||||| ||||||||||    
T  32470300 attttgatagatggtgatgatgttgttgttgaattgatgatgatgttgttg 32470350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 34; Significance: 0.0000000006; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 54 - 107
Target Start/End: Complemental strand, 22552254 - 22552201
Alignment:
Q  54 ggcgttggggttacgactgcgactgcagcgtttgttgcggtggttggaagggga 107  Q
    |||||||||||||||||| ||||  |  ||||||||||||||||||||||||||    
T  22552254 ggcgttggggttacgactacgacgacgacgtttgttgcggtggttggaagggga 22552201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 357 - 394
Target Start/End: Complemental strand, 32694301 - 32694264
Alignment:
Q  357 gtgatgatgttgctgttgaattgatgacgatgttgttg 394  Q
    ||||||||||||||||||||||||||| ||||||||||    
T  32694301 gtgatgatgttgctgttgaattgatgatgatgttgttg 32694264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 357 - 394
Target Start/End: Complemental strand, 32797528 - 32797491
Alignment:
Q  357 gtgatgatgttgctgttgaattgatgacgatgttgttg 394  Q
    ||||||||||||||||||||||||||| ||||||||||    
T  32797528 gtgatgatgttgctgttgaattgatgatgatgttgttg 32797491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 357 - 394
Target Start/End: Complemental strand, 30858285 - 30858248
Alignment:
Q  357 gtgatgatgttgctgttgaattgatgacgatgttgttg 394  Q
    ||||||||||||||||||||||||||| ||||||||||    
T  30858285 gtgatgatgttgctgttgaattgatgatgatgttgttg 30858248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 359 - 404
Target Start/End: Complemental strand, 38241291 - 38241246
Alignment:
Q  359 gatgatgttgctgttgaattgatgacgatgttgttgctgctattgt 404  Q
    |||||||||| |||||||||||||| | ||||||||||||||||||    
T  38241291 gatgatgttgttgttgaattgatgatgttgttgttgctgctattgt 38241246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0118 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0118
Description:

Target: scaffold0118; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 357 - 394
Target Start/End: Complemental strand, 42683 - 42646
Alignment:
Q  357 gtgatgatgttgctgttgaattgatgacgatgttgttg 394  Q
    |||||||||||| |||||||||||||| ||||||||||    
T  42683 gtgatgatgttgttgttgaattgatgatgatgttgttg 42646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 228 - 256
Target Start/End: Complemental strand, 33962337 - 33962309
Alignment:
Q  228 aaaaaatgggggagattgcagcatttgtt 256  Q
    |||||||||||||||||||||||||||||    
T  33962337 aaaaaatgggggagattgcagcatttgtt 33962309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University