View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0756_low_8 (Length: 392)
Name: NF0756_low_8
Description: NF0756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0756_low_8 |
 | |
|
| [»] scaffold0971 (2 HSPs) |
| | |
|
| [»] scaffold0899 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0971 (Bit Score: 176; Significance: 1e-94; HSPs: 2)
Name: scaffold0971
Description:
Target: scaffold0971; HSP #1
Raw Score: 176; E-Value: 1e-94
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 767 - 974
Alignment:
| Q |
1 |
agagaatagtatgcataacaaaggttttggttactattttatgcagatttggcagtgttgacacaaatcagttaataaatttt-gctaaggtttctcgga |
99 |
Q |
| |
|
|||||||||||||||||||| ||||| || ||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| ||||||||||| |
|
|
| T |
767 |
agagaatagtatgcataacacaggttgtgattactattttatgcagatttggcagtgttgacacaaatcagttgataaatttttgctatggtttctcgga |
866 |
T |
|
| Q |
100 |
gcatctggatggaacgaaatgtgcactaataggacagcaaggtagagtttgatcaagtaatgcagtgcgccagcgctgtgtttcactgtttcttattgtc |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
867 |
gcatctggatggaacgaaatgtgcactaataggacagcaaggtcgagtttgatcaagtaatgcagtgcgccagcgctgtgtttcactgtttcttattgtc |
966 |
T |
|
| Q |
200 |
acaactat |
207 |
Q |
| |
|
|||||||| |
|
|
| T |
967 |
acaactat |
974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0971; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 205 - 295
Target Start/End: Original strand, 1060 - 1150
Alignment:
| Q |
205 |
tattagaaagccaacaacaaacaatattgtgaacaaatataacttagaaaaggttgaccaatccaatgattggtatgcttgatgtggaata |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1060 |
tattagaaagccaacaacaaacaatattgtgaacaaatataacttagaaaaggttgaccaatccaatgtttggtatgcttgatgtggaata |
1150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0899 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0899
Description:
Target: scaffold0899; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 239 - 281
Target Start/End: Complemental strand, 2781 - 2739
Alignment:
| Q |
239 |
aaatataacttagaaaaggttgaccaatccaatgattggtatg |
281 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
2781 |
aaatctaacttagaaaaggttgactaatccaatgattgatatg |
2739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University