View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0757-INSERTION-3 (Length: 386)
Name: NF0757-INSERTION-3
Description: NF0757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0757-INSERTION-3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 117; Significance: 2e-59; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 176 - 384
Target Start/End: Original strand, 3270073 - 3270277
Alignment:
| Q |
176 |
ggtcttagaagtgataattataatttcaattctgattatgaataggaaataccaattttgtggcaaaaatcatcacttttgaaacaaacnnnnnnnccat |
275 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3270073 |
ggtcttagaagtgataattat---ttcaattctgattatgaataggaaataccaattttgtggcaaaaatcatcacttttgaaacaaacaaaaaaaccat |
3270169 |
T |
 |
| Q |
276 |
tgnnnnnnnnnnnnaaggttacaaacttgaattaaaaccaagattaccataaatgtgatgcttgagtgatcaaatggtttattttcaaaaagaaatgact |
375 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
3270170 |
tgtatttattttt-aaggttacaaacttgaattaaaaccaagattagcataaatgtgatacttgagtgatccaatagtttattttcaaaaagaaatgact |
3270268 |
T |
 |
| Q |
376 |
attttcttg |
384 |
Q |
| |
|
||||||||| |
|
|
| T |
3270269 |
attttcttg |
3270277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 38 - 144
Target Start/End: Original strand, 3269935 - 3270041
Alignment:
| Q |
38 |
aaagtccctctataatttatcatgctttaaaaaatagtctcgctctttttaagatcaaacttttttgtccttaaaatatcatacttattgtaattttgtt |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3269935 |
aaagtccctctataatttatcatgctttaaaaaatagtctcgctctttttaagatcaaacttttttgtccttaaaatatcatacttattgtaattttgtt |
3270034 |
T |
 |
| Q |
138 |
tcgaaac |
144 |
Q |
| |
|
||||||| |
|
|
| T |
3270035 |
tcgaaac |
3270041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University