View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0757_high_6 (Length: 256)
Name: NF0757_high_6
Description: NF0757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0757_high_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-116; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 13 - 227
Target Start/End: Complemental strand, 36387996 - 36387782
Alignment:
| Q |
13 |
cagagtttagggaaaactgtttgttgcgtttcgaagtggaagtggagggttgcaagataaagaagtgtggttggcctgtgttgcacaaggaagattatct |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36387996 |
cagagtttagggaaaactgtttgttgcgtttcgaagtggaagtggagggttgcaagataaagaagtgtggttggcctgtgttgcacaaggaagattatct |
36387897 |
T |
 |
| Q |
113 |
tgaagacttagaggtgagcaacagtgaaaattatgcggcaccttcaaattccaagcatttcagtggtatgcgcaaatcaagattggataaattgatagaa |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36387896 |
tgaagacttagaggtgagcaacagtgaaaattatgcggcactttcaaattccaagcatttcagtggtatgcgcaaatcaagattggataaattgatagaa |
36387797 |
T |
 |
| Q |
213 |
gagattgatgctttt |
227 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
36387796 |
gagattgatgctttt |
36387782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 13 - 121
Target Start/End: Complemental strand, 36404723 - 36404615
Alignment:
| Q |
13 |
cagagtttagggaaaactgtttgttgcgtttcgaagtggaagtggagggttgcaagataaagaagtgtggttggcctgtgttgcacaaggaagattatct |
112 |
Q |
| |
|
||||||| || |||||| ||| |||||||| ||||| ||||||| || |||||||||| ||||||||| |||| | |||||| ||||||||||||||| |
|
|
| T |
36404723 |
cagagttaagcgaaaacagttcattgcgttttgaagtacaagtggaagggtgcaagataaggaagtgtgggtggcgtatgttgcgcaaggaagattatct |
36404624 |
T |
 |
| Q |
113 |
tgaagactt |
121 |
Q |
| |
|
||||||||| |
|
|
| T |
36404623 |
tgaagactt |
36404615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University