View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0757_low_14 (Length: 277)
Name: NF0757_low_14
Description: NF0757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0757_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 7e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 7e-89
Query Start/End: Original strand, 47 - 224
Target Start/End: Original strand, 44698835 - 44699012
Alignment:
Q |
47 |
acatcatcatgatatgtttacttctctgttctttctttctttttgtctaaagcatctgaacagtttttagataactaggatttggatttgtacgtggagt |
146 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
44698835 |
acatcatcatgatatgtttccttctctgttctttctttctttttgtctaaagcatctgaacagttattagataactaggatttggatttgtacgtggagt |
44698934 |
T |
 |
Q |
147 |
tggattgtttctttctacatttacttcttttacacgcaacgcaaacaagaccagagagtgagaagtagaaggaatgat |
224 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
44698935 |
tggattgtttctttctacatttacttcttttacacgcaacgcaaacaagaccagagagtgagatgtagaaggaatgat |
44699012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University