View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0757_low_21 (Length: 211)
Name: NF0757_low_21
Description: NF0757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0757_low_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 1 - 127
Target Start/End: Original strand, 13234208 - 13234334
Alignment:
Q |
1 |
tttttctatcaagactaatggtcctcaccttcatgggagttatgatggcaacaatgttccacaatccaaaaaataccttacaaggaatcacaaatcgtct |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
13234208 |
tttttctatcaagactaatggtcctcaccttcatgggagttatgatggcaacaatgttccacaatccaaaaaataccttacaaggaatcacaaatcgtct |
13234307 |
T |
 |
Q |
101 |
cagtttcttcattttcacagtgtgtct |
127 |
Q |
|
|
||||||||||||||||||||||||||| |
|
|
T |
13234308 |
cagtttcttcattttcacagtgtgtct |
13234334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University