View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0758_high_17 (Length: 255)
Name: NF0758_high_17
Description: NF0758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0758_high_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 112 - 222
Target Start/End: Complemental strand, 1289961 - 1289851
Alignment:
| Q |
112 |
atatttagtagacaaactggaaggtgttaaagttgataaagctgagatatactttaatgtataaatccgataatttcttcataaatttgtggaacattga |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1289961 |
atatttagtagacaaactggaaggtgttaaagttgataaagctgagatatactttaatgtataaatccgataatttcttcataaatttgtggaacattga |
1289862 |
T |
|
| Q |
212 |
gtagcaatatg |
222 |
Q |
| |
|
||||||||||| |
|
|
| T |
1289861 |
gtagcaatatg |
1289851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 15 - 76
Target Start/End: Complemental strand, 1290090 - 1290029
Alignment:
| Q |
15 |
cacagatctagccactatgttctacacttaattttttagttctatctagtggaggttcagtt |
76 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
1290090 |
cacagatctagccactatgttctacacttaattttctagttctatctagtggaggttcagtt |
1290029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 18 - 76
Target Start/End: Complemental strand, 14139220 - 14139162
Alignment:
| Q |
18 |
agatctagccactatgttctacacttaattttttagttctatctagtggaggttcagtt |
76 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
14139220 |
agatctagccactatgttctacacttaattttctagttctatccggtggaggttcagtt |
14139162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4141 times since January 2019
Visitors: 4827