View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0758_high_18 (Length: 251)
Name: NF0758_high_18
Description: NF0758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0758_high_18 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 149 - 251
Target Start/End: Complemental strand, 33825572 - 33825470
Alignment:
| Q |
149 |
taaaaggaagagattaaaagaaataattaattagtttagttagatcatatggaaaaacatattaaaccataaagtttttagtggaccaaataagagtatc |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
33825572 |
taaaaggaagagattaaaagaaataattaattagtttagttagatcatatggaaaaacatattaaaccctaaagtttttagtggaccaaataagtgtatc |
33825473 |
T |
|
| Q |
249 |
cca |
251 |
Q |
| |
|
||| |
|
|
| T |
33825472 |
cca |
33825470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 28 - 73
Target Start/End: Complemental strand, 33825684 - 33825639
Alignment:
| Q |
28 |
cactagaatcaccagctccatgtcagactctagtatagtgttgatc |
73 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33825684 |
cactagaatcaccagctccatgtcagactctagtatagtgttgatc |
33825639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5294 times since January 2019
Visitors: 4847