View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0758_low_31 (Length: 318)
Name: NF0758_low_31
Description: NF0758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0758_low_31 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 97; Significance: 1e-47; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 68 - 180
Target Start/End: Original strand, 15639054 - 15639166
Alignment:
| Q |
68 |
tttgggagttaaacaaagaaatattcatagaaatcataattaaatgaatttgagagtaaactgtttgaggataatttatgcatattcataacaaactaaa |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||| |||||| | |
|
|
| T |
15639054 |
tttgggagttaaacaaagaaatattcatagaaatcataattcaatgaatttgagagtaaacggtttgaggataatttatgcatattcataataaactaca |
15639153 |
T |
|
| Q |
168 |
ccaagaaagtata |
180 |
Q |
| |
|
||||||||||||| |
|
|
| T |
15639154 |
ccaagaaagtata |
15639166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3543 times since January 2019
Visitors: 4814