View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0758_low_37 (Length: 315)
Name: NF0758_low_37
Description: NF0758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0758_low_37 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 71; Significance: 4e-32; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 94 - 164
Target Start/End: Complemental strand, 16471678 - 16471608
Alignment:
Q |
94 |
tcatattctaataatttgagacaaacaaatagaactaaaagggacaaaatcacttggcttggttttgctta |
164 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
16471678 |
tcatattctaataatttgagacaaacaaatagaactaaaagggacaaaatcacttggcttggttttgctta |
16471608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 227
Target Start/End: Complemental strand, 5263647 - 5263555
Alignment:
Q |
135 |
ggacaaaatcacttggcttggttttgcttagaaacatgataatccctttggccttggaattaggtctaaggcaatatgatgcaaaacttgttg |
227 |
Q |
|
|
||||||||||| ||| ||| ||||| |||||||||||||||| | |||||| ||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
5263647 |
ggacaaaatcagttgcgatggctttgcatagaaacatgataatctcattggccatggaatttggtctaaggcaatatgatgcaaaacttgttg |
5263555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University