View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0758_low_44 (Length: 272)
Name: NF0758_low_44
Description: NF0758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0758_low_44 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 9 - 244
Target Start/End: Original strand, 47252927 - 47253162
Alignment:
Q |
9 |
gaaaaatatgacatttgatttaggtaaagaacattattattaaaaatccacctaatttcagtccttcacaaaacatccagatccagctcagtttatttcg |
108 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47252927 |
gaaaaatatgacatttgatttaggtaaagaacattattattaaaaatccacctaatttcagtccttcacaaaacatccagatccagctcagtttatttcg |
47253026 |
T |
 |
Q |
109 |
tgcacactaacttggatcttagtcaaatcaaacaattactctgtcttttatttattaataaaacagctatgtttgacatgaatcctcttttctataatag |
208 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||| |
|
|
T |
47253027 |
tgcacactaacttggatcttagtcaaatcaaacaattactctgtcttttatttattaataaaacagctatgattgacatgaatcctcttttctttaatag |
47253126 |
T |
 |
Q |
209 |
aattgttaccttattggtttatggtcccttcttcct |
244 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |
|
|
T |
47253127 |
aattgttaccttattggtttatggtcccttcttcct |
47253162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University