View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0758_low_54 (Length: 260)
Name: NF0758_low_54
Description: NF0758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0758_low_54 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 52 - 239
Target Start/End: Original strand, 13762129 - 13762316
Alignment:
Q |
52 |
tgttcactttatatatcaatgtcaatggtgttattattatttttaatttttgaataaatattgattctgttattcctacannnnnnnnacacgcttgcgc |
151 |
Q |
|
|
|||||| |||||||||||||||| |||||||| |||||||||||||||||||||||||| ||||||||||||||| ||| |||||||||||| |
|
|
T |
13762129 |
tgttcattttatatatcaatgtcgatggtgttgttattatttttaatttttgaataaattttgattctgttattctcacattttttttacacgcttgcgc |
13762228 |
T |
 |
Q |
152 |
cacataatcagcgcaacgatttacttttactgtccatcgtggatatgccgccatcatatgtagtgttgctgcagatgcgggtgatgat |
239 |
Q |
|
|
|||||||||||||||||||||||||||||||| |||||||||| |||||||||||||| ||||||||||||||||||| | ||||||| |
|
|
T |
13762229 |
cacataatcagcgcaacgatttacttttactgcccatcgtggagatgccgccatcataagtagtgttgctgcagatgctgatgatgat |
13762316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University