View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0758_low_57 (Length: 257)
Name: NF0758_low_57
Description: NF0758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0758_low_57 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 141 - 224
Target Start/End: Complemental strand, 33010358 - 33010275
Alignment:
| Q |
141 |
ggatgtctaaatttatcccggtgatcttatttttcaactagtcctgaaaccacgtttactactacttgtataacatgaaaaatt |
224 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33010358 |
ggatgtccgaatttttcccggtgatcttatttttcaactagccctgaaaccacgtttactactacttgtataacatgaaaaatt |
33010275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 47 - 100
Target Start/End: Complemental strand, 33010447 - 33010394
Alignment:
| Q |
47 |
tgtactgttgatttttaggaagctatttgtttattataatagagatagagatag |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
33010447 |
tgtactgttgatttttaggaagccgtttgtttattataatagagatagagatag |
33010394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University