View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0758_low_57 (Length: 257)

Name: NF0758_low_57
Description: NF0758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0758_low_57
NF0758_low_57
[»] chr6 (2 HSPs)
chr6 (141-224)||(33010275-33010358)
chr6 (47-100)||(33010394-33010447)


Alignment Details
Target: chr6 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 141 - 224
Target Start/End: Complemental strand, 33010358 - 33010275
Alignment:
141 ggatgtctaaatttatcccggtgatcttatttttcaactagtcctgaaaccacgtttactactacttgtataacatgaaaaatt 224  Q
    |||||||  ||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
33010358 ggatgtccgaatttttcccggtgatcttatttttcaactagccctgaaaccacgtttactactacttgtataacatgaaaaatt 33010275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 47 - 100
Target Start/End: Complemental strand, 33010447 - 33010394
Alignment:
47 tgtactgttgatttttaggaagctatttgtttattataatagagatagagatag 100  Q
    |||||||||||||||||||||||  |||||||||||||||||||||||||||||    
33010447 tgtactgttgatttttaggaagccgtttgtttattataatagagatagagatag 33010394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University