View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0758_low_61 (Length: 251)

Name: NF0758_low_61
Description: NF0758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0758_low_61
NF0758_low_61
[»] chr8 (2 HSPs)
chr8 (149-251)||(33825470-33825572)
chr8 (28-73)||(33825639-33825684)


Alignment Details
Target: chr8 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 149 - 251
Target Start/End: Complemental strand, 33825572 - 33825470
Alignment:
149 taaaaggaagagattaaaagaaataattaattagtttagttagatcatatggaaaaacatattaaaccataaagtttttagtggaccaaataagagtatc 248  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||    
33825572 taaaaggaagagattaaaagaaataattaattagtttagttagatcatatggaaaaacatattaaaccctaaagtttttagtggaccaaataagtgtatc 33825473  T
249 cca 251  Q
    |||    
33825472 cca 33825470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 28 - 73
Target Start/End: Complemental strand, 33825684 - 33825639
Alignment:
28 cactagaatcaccagctccatgtcagactctagtatagtgttgatc 73  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
33825684 cactagaatcaccagctccatgtcagactctagtatagtgttgatc 33825639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University