View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0758_low_67 (Length: 228)
Name: NF0758_low_67
Description: NF0758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0758_low_67 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 50 - 84
Target Start/End: Complemental strand, 34070402 - 34070368
Alignment:
| Q |
50 |
ggccaatcatgtaatgatttcttagctattctcac |
84 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
34070402 |
ggccaatcatgtaatgatttcttagctattctcac |
34070368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University