View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0758_low_67 (Length: 228)

Name: NF0758_low_67
Description: NF0758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0758_low_67
NF0758_low_67
[»] chr6 (1 HSPs)
chr6 (50-84)||(34070368-34070402)


Alignment Details
Target: chr6 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 50 - 84
Target Start/End: Complemental strand, 34070402 - 34070368
Alignment:
50 ggccaatcatgtaatgatttcttagctattctcac 84  Q
    |||||||||||||||||||||||||||||||||||    
34070402 ggccaatcatgtaatgatttcttagctattctcac 34070368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University