View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0758_low_68 (Length: 223)

Name: NF0758_low_68
Description: NF0758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0758_low_68
NF0758_low_68
[»] chr3 (1 HSPs)
chr3 (1-107)||(8465528-8465634)


Alignment Details
Target: chr3 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 1 - 107
Target Start/End: Complemental strand, 8465634 - 8465528
Alignment:
1 catcatcattcataatggtagtaggtgttggatttttgtgctatatttgatacaataagtggctcatttcgatgcttctctcttcatcattcattcactc 100  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
8465634 catcataattcataatggtagtaggtgttggatttttgtgctatatttgatacaataagtggctcatttcgatgcttctctgttcatcattcattcactc 8465535  T
101 actctct 107  Q
    |||||||    
8465534 actctct 8465528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University