View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0758_low_7 (Length: 461)
Name: NF0758_low_7
Description: NF0758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0758_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 358; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 358; E-Value: 0
Query Start/End: Original strand, 30 - 446
Target Start/End: Original strand, 40885582 - 40885997
Alignment:
| Q |
30 |
cggactggagaacaatattcctatgggaacaatatgtctgcttaccctacaacatatcccagtggatactatccccctccatcagggtcctactatcaga |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40885582 |
cggactggagaacaatattcctatgggaacaatatgtctgcttaccctacaacatatcccagtggatactatccccctccatcagggtcctactatcaga |
40885681 |
T |
 |
| Q |
130 |
attttgatccctatcaaaattatgatccttattttggtcctcagactcatggttatcctccatataacaattattatatgtaaaacagatggatctatca |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | || |
|
|
| T |
40885682 |
attttgatccctatcaaaattatgatccttattttggtcctcagactcatggttatcctccatataacaattattatatgtaaaacagatggatgttgca |
40885781 |
T |
 |
| Q |
230 |
ccactccaacagtatagtattagtatcactgttggtgtttttgtgnnnnnnnattaagtcctttgtattggtattaggtcatataaaattgatttatgac |
329 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40885782 |
ccactccaacagtatagtattagtatcactgttggtgtttttgtg-ttttttattaagtcctttgtattggtattaggtcatataaaattgatttatgac |
40885880 |
T |
 |
| Q |
330 |
ctaatgctttgtcctagtatatgatcacatgagatccnnnnnnngtaaggttactgctatgattgtggaccgatatttatggttcattattatgaagttt |
429 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40885881 |
ctaatgctttgtcctagtatatgatcacatgagatcctttttttgtaaggttactgctatgattgtggaccgatatttatggttcattattatgaagttt |
40885980 |
T |
 |
| Q |
430 |
aatgtgatcctcgttat |
446 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
40885981 |
aatgtgatcctcgttat |
40885997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University