View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0758_low_70 (Length: 215)
Name: NF0758_low_70
Description: NF0758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0758_low_70 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 20 - 153
Target Start/End: Complemental strand, 6829132 - 6828999
Alignment:
| Q |
20 |
aattcgcataaagcctcggagacatttcattctatcctccacagcttgtatttgcgtatcaaggttgataaatttgaaatcccctttgagagactgaaca |
119 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6829132 |
aattcgaataaagcctcggagacacttcattctatcctccacagcttgtatttgcgtatcaaggttgataaatttgaaatcccctttgagagactgaaca |
6829033 |
T |
 |
| Q |
120 |
tttaccaaaacaccatccaacttagcaagtgcag |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
6829032 |
tttaccaaaacaccatccaacttagcaagtgcag |
6828999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University