View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0758_low_71 (Length: 213)

Name: NF0758_low_71
Description: NF0758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0758_low_71
NF0758_low_71
[»] chr5 (1 HSPs)
chr5 (1-121)||(36544334-36544454)


Alignment Details
Target: chr5 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 1 - 121
Target Start/End: Complemental strand, 36544454 - 36544334
Alignment:
Q  1 atcgattgctttgcttatttcggataaataacctgaccctttaagggaattggttgggaaggaaagttgttgttttggagagggaattgtgtggtgaaat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  36544454 atcgattgctttgcttatttcggataaataacctgaccctttaagggaattggttgggaaggaaagttgttgttttggagagggaattgtgtggtgaaat 36544355  T
Q  101 gggaaaatttgtgggggtttg 121  Q
    |||||||||||||||||||||    
T  36544354 gggaaaatttgtgggggtttg 36544334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University