View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0758_low_72 (Length: 211)
Name: NF0758_low_72
Description: NF0758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0758_low_72 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 199
Target Start/End: Original strand, 43244871 - 43245069
Alignment:
| Q |
1 |
ggtgattggtatttggactcaattgccttcactttgtcaagtgcacccacaaaatctctgcttcagaaggtgcagagaggcttgtataggctcacaagca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43244871 |
ggtgattggtatttggactcaattgccttcactttgtcaagtgcacccacaaaatctctgcttcagaaggtgcagagaggcttgtataggctcacaagca |
43244970 |
T |
 |
| Q |
101 |
ttgctccaaaatcttcatccacttgggctgcttagaagactatatatgggaatttaagcctcttgcctcagtattgagtaatttggttcatgctatatt |
199 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43244971 |
ttgctccaaaatcttcttccactagggctgcttagaagactatatatgggaatttaagcctcttgcctcagtcttgagtaatttggttcatgctatatt |
43245069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 30 - 141
Target Start/End: Original strand, 39866039 - 39866140
Alignment:
| Q |
30 |
cactttgtcaagtgcacccacaaaatctctgcttcagaaggtgcagagaggcttgtataggctcacaagcattgctccaaaatcttcatccacttgggct |
129 |
Q |
| |
|
|||||| || |||||||||||||| ||||||||||| |||||||||||||||| || |||||||||||||||||||||||||| |||| |
|
|
| T |
39866039 |
cactttatctagtgcacccacaaagtctctgcttcataaggtgcagagaggctcgt----------aagcattgctccaaaatcttcatccaacaaggct |
39866128 |
T |
 |
| Q |
130 |
gcttagaagact |
141 |
Q |
| |
|
|||||||||||| |
|
|
| T |
39866129 |
gcttagaagact |
39866140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University