View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0758_low_74 (Length: 205)
Name: NF0758_low_74
Description: NF0758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0758_low_74 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 79; Significance: 4e-37; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 98 - 176
Target Start/End: Original strand, 43194323 - 43194401
Alignment:
| Q |
98 |
aagttaagattgaaccgttcaggtaacctaaccaaaacaaactaagttaagtcacctgaacgattcaatctcaaaatac |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43194323 |
aagttaagattgaaccgttcaggtaacctaaccaaaacaaactaagttaagtcacctgaacgattcaatctcaaaatac |
43194401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 98 - 170
Target Start/End: Original strand, 43194495 - 43194567
Alignment:
| Q |
98 |
aagttaagattgaaccgttcaggtaacctaaccaaaacaaactaagttaagtcacctgaacgattcaatctca |
170 |
Q |
| |
|
|||| ||||||||| ||||||| |||||||||||||||||||| ||| |||| | |||||||||||||||| |
|
|
| T |
43194495 |
aagtcaagattgaatcgttcagataacctaaccaaaacaaactcgattaggtcatcagaacgattcaatctca |
43194567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3004 times since January 2019
Visitors: 4805