View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0758_low_75 (Length: 205)

Name: NF0758_low_75
Description: NF0758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0758_low_75
NF0758_low_75
[»] chr2 (1 HSPs)
chr2 (141-205)||(32866779-32866844)


Alignment Details
Target: chr2 (Bit Score: 58; Significance: 1e-24; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 141 - 205
Target Start/End: Complemental strand, 32866844 - 32866779
Alignment:
141 agtttgtttgtttgat-aaagttcaaacgttatccactaggtagagaatatgtatattttatgttc 205  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
32866844 agtttgtttgtttgatcaaagttcaaacgttatccactaggtagagaatatgtatattttatgttc 32866779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 5492 times since January 2019
Visitors: 4854