View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0758_low_75 (Length: 205)
Name: NF0758_low_75
Description: NF0758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0758_low_75 |
 |  |
|
[»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 58; Significance: 1e-24; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 141 - 205
Target Start/End: Complemental strand, 32866844 - 32866779
Alignment:
Q |
141 |
agtttgtttgtttgat-aaagttcaaacgttatccactaggtagagaatatgtatattttatgttc |
205 |
Q |
|
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32866844 |
agtttgtttgtttgatcaaagttcaaacgttatccactaggtagagaatatgtatattttatgttc |
32866779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5492 times since January 2019
Visitors: 4854