View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0758_low_78 (Length: 201)
Name: NF0758_low_78
Description: NF0758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0758_low_78 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 29 - 170
Target Start/End: Complemental strand, 38051380 - 38051239
Alignment:
| Q |
29 |
ggcatgcacaaaatgaatcataagctagtcgagtgcaccataaaatctgttgcaaagaatcccaagtccagtcatgcatgagcttggaggggaaatttac |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38051380 |
ggcatgcacaaaatgaatcataagctagtcgagtgcaccataaaatctgttgcaaagaatcccaagtccagtcatgcatgagcttggaggggaaatttac |
38051281 |
T |
|
| Q |
129 |
atgcatacatttgcatgagctaggtggagtgtccaattcaat |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38051280 |
atgcatacatttgcatgagctaggtggagtgtccaattcaat |
38051239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3307 times since January 2019
Visitors: 4812