View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0759_high_26 (Length: 317)
Name: NF0759_high_26
Description: NF0759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0759_high_26 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 1 - 307
Target Start/End: Original strand, 29447101 - 29447407
Alignment:
Q |
1 |
cactactctcttccgagctgccttcatatgaggcctcaactatccttcctgattttgaaccttgtgtcccaactgacaaggaggaatcctcggattcact |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||| |
|
|
T |
29447101 |
cactactctcttccgagctgccttcatatgaggcctcaactatccttcctgattttgaaccttgtgtcccaactgacaaggaggaaccctcggatacact |
29447200 |
T |
 |
Q |
101 |
accaacatcggcactgtcttgctgagaagtccattgagaagaagagtctgagtttgagcttgattcctcttgttcatgaagttgtggttgaaccatggtc |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29447201 |
accaacatcggcactgtcttgctgagaagtccattgagaagaagagtctgagtttgagattgattcctcttgttcatgaagttgtggttgaaccatggtc |
29447300 |
T |
 |
Q |
201 |
ttcaaaggttcaacatgacctatcttatgagttcctctctgatccaaaactggccagtctctgtctctatgttgatgggaattcacctttatgtcacttg |
300 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29447301 |
ttcaaaggttcaacatgacctatcttatgagttcctctctgatccaaaactggccagtctctgtctctatgttgatgggaattcacctttatgtcacttg |
29447400 |
T |
 |
Q |
301 |
atctctg |
307 |
Q |
|
|
||||||| |
|
|
T |
29447401 |
atctctg |
29447407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3237 times since January 2019
Visitors: 4808